Probing Sporadic and Familial Alzheimer's Disease Using Induced Pluripotent Stem Cells

Introduction

Alzheimer's disease (AD) is a major degenerative disorder of the primal nervous system characterized by continuous neuronal loss by and large in the cerebral cortex and the hippocampus, mainly caused by the accumulations of amyloid plaques and neurofibrillary tangles, which leads to pathological changes in the functional organization and the internal structure of the encephalon and therefore to progressive loss of memory and cerebral damage (Sanabria-Castro et al., 2017; Reiss et al., 2018). The boilerplate life expectancy of patients with this disorder is eight–x years; all the same, clinical symptoms are preceded by prodromal symptoms that extend over 2 decades and somewhen cause death (Wilson et al., 2011; Masters et al., 2015).

Most cases of AD (>95%) are commonly diagnosed in people over 65 years of historic period, known as tardily-onset form (LOAD), and is the consequence of the failure of the homeostatic networks in the brain tissue to clear the amyloid-β (Aβ) peptide; additionally, there is a less frequent early-onset hereditary form (EOAD; 2–5% of cases), usually caused by an autosomal ascendant genetic mutation in three known genes. These genes encode for amyloid precursors protein (APP), presenilin 1 (PS1), and presenilin ii (PS2), which affect the normal processing of Aβ and crusade the development of the disease at early stages (~45 years; Masters et al., 2015; Cacace et al., 2016). Among these, mutations in PSEN1 and PSEN2 genes are highly penetrant, representing approximately 90% of all identified in EOAD and existence the virtually mutual and usually associated with a very aggressive EOAD, with 221 mutations for PSEN1 reported in the Alzforum database1 (Ryan and Rossor, 2010; Kelleher and Shen, 2017; Lanoiselée et al., 2017). Birthday, the pathological hallmarks of EOAD and LOAD are mostly like; hence, it is difficult to distinguish the ii AD forms by any other criterion than the onset historic period (Masters et al., 2015). Hence, Advertising represents a meaning public health problem and represents an increasing clinical challenge in terms of diagnosis and handling.

Historically, in vivo and in vitro systems have constituted powerful models to defining the disquisitional disease-related pathophysiology and in exploring novel potential therapeutic approaches (Saraceno et al., 2013; Penney et al., 2020). Despite many aspects of the mechanisms of Advertising that take been elucidated thanks to the use of these models, specific molecular mechanisms leading to neurodegeneration are notwithstanding unknown then that neither cure nor therapeutic approaches are also available (Alonso Vilatela et al., 2012; Graham et al., 2017); too, knowledge gaps remain, due to significant limitations such as human encephalon physiology complication, express availability of man brain tissue, and the lack of in vivo and in vitro models that reliably restate the disease phenotype (D'Avanzo et al., 2015; Logan et al., 2019). Better and relevant AD platforms are needed to recapitulate detail features of the pathology that cannot be recreated in current Advertizing models. To fill this gap, in the final years, the evolution of patient-derived AD disease models by generating iPSC from AD patient somatic cells, further differentiated into neural cells, have revolutionized the human in vitro models (Penney et al., 2020). The institution of these culture techniques represents one of the most innovative biomedical advances in this century, mainly because these patient-specific cells contain genetic information from donors, and in consequence, information technology offers an opportunity to develop physiologically relevant in vitro disease models (Yagi et al., 2011; Israel et al., 2012; Mohamet et al., 2014; Sproul et al., 2014; Hossini et al., 2015; Liao et al., 2016; Logan et al., 2019).

Yet, to study more accurately the human being encephalon complexity, 3D prison cell models, including scaffolds-based systems and scaffold-free systems (eastward.one thousand., gels and spheroids, respectively; Logan et al., 2019), have emerged as an innovative and advanced alternative driven by their resemblance to some in vivo environmental and architecture characteristics, for example, by allowing complex intercellular communication, the germination of circuitous structures, too equally a amend spatial organization, better jail cell behavior, and specific chemical and physical cues, essential for the study of human brain diseases at cellular and molecular levels. Also, 3D environments can promote ameliorate neuronal differentiation and neural network formation (Choi et al., 2014; Zhang et al., 2014; Ravi et al., 2015; Fang and Eglen, 2017).

Consequently, the use of iPSC-derived neurons in 3D prison cell cultures has been implemented to obtain and employ cells with a specific genetic groundwork of Advertising patients in a arrangement of college similarity to the medium in vivo that provides a local environment brain tissue-like that promotes Advertizement-similar phenotypes such equally elevated Aβ production and tau hyperphosphorylation, its assemblage, and accumulation (D'Avanzo et al., 2015; Raja et al., 2016; Gonzalez et al., 2018; Logan et al., 2019; de Leeuw and Tackenberg, 2019).

With the combined approaches offered by these techniques, in vitro AD modeling has gained increasing interest for the study of the pathological mechanisms underlying the affliction as well every bit in pharmacological testing platforms and developing therapeutic personalized strategies due to their demonstrated benefits in providing physiologically relevant information and more than predictive information for in vivo tests (D'Avanzo et al., 2015; Logan et al., 2019; Penney et al., 2020).

Evidence from many laboratories supports those mentioned above; for example, Zhang et al. (2014) modeled AD in a hydrogel-based 3D culture using human neuroepithelial-similar stem cells which were exposed to a constructed preparation of Aβ-42 oligomers. They resemble the contradistinct p21-activated kinase distribution found in AD patients and demonstrated their utility in studying the Aβ-induced pathogenesis (Zhang et al., 2014). On the other manus, Choi et al. (2014) demonstrated the robust deposition of Aβ and filamentous tau in a hydrogel-based 3D model of Advertising using genetically modified human neural stem cells which overexpressed mutant APP and PSEN1 (Kim et al., 2015). This model consists of genetically modified cells, not cells with AD genetic groundwork. On the other mitt, Raja et al. (2016) recapitulated Ad phenotypes such as considerably elevated production of Aβ, Aβ aggregation, and tau protein hyperphosphorylation, apparent later on threescore and 90 days in culture, using iPSC-derived organoids carrying AD mutations. These self-organizing AD 3D models efficiently produce Advertizement phenotypes without genetic manipulation or exogenous toxins (Raja et al., 2016). Notwithstanding, self-organizing organoids lack cytoarchitectural structures, and they likewise have difficulties in decision-making their microenvironment and food access, while in hydrogel-based 3D cultures, this is more controllable (de Leeuw and Tackenberg, 2019).

Hither, nosotros present the establishment of a novel human hydrogel-based 3D model of Advertising with iPSC-derived neurons carrying the A246E mutation in the PSEN1 gene that produces Aβ oligomers that were detected from twenty-four hours xiv of differentiation with no need to induce AD-related mutations or external add-on of synthetic Aβ. This work provides guidelines in the evolution and implementation of early disease models for mechanistic studies, preclinical drug discovery, and the pattern of personalized therapeutic strategies.

Materials and Methods

Human being Fibroblasts (HFs) Culture and Human iPSC Generation

Human fibroblasts (HFs) with PSEN1 A246E mutation (Coriell True cat# AG07768, RRID: CVCL_T877) and non-mutated HFs (ATCC Cat# SCRC-1041, RRID: CVCL_3285) were reprogrammed with lentiviral vectors containing Yamanaka'due south factors (Takahashi and Yamanaka, 2006) with few modifications (Cevallos et al., 2018). HEK293T packaging cell line (ATCC Cat# CRL-3216, RRID: CVCL_0063) was used to generate lentiviral particles. HEK293T cells of 80% confluence were transfected with envelope pCMV-VSV-G (RRID: Addgene_8454), packaging plasmid psPAX2 (RRID: Addgene_12260), and transfer pSIN4-CMV-K2M (RRID: Addgene_21164) encoding KLF4 and C-MYC and pSIN4-EF2-O2S encoding OCT4 and SOX2 (RRID: Addgene_21162) in a 1:three:4 ratio (20 μg total DNA), and a positive transfection control was included, pLENTI-CMV-GFP-puro (RRID: Addgene_17448) encoding GFP. Dna/calcium phosphate precipitates were generated using CalPhos Mammalian Transfection Kit (Clontech, CA, Us), added dropwise to HEK293T cells and incubated for 6–vii h in standard prison cell civilization conditions. Then, cells were done with PBS and cultured in medium DMEM/F12 supplemented with x% fetal bovine serum. At 12, 24, and 36 h mail service transfection, the virus-containing supernatant was collected, filtered through a 0.45-μm-pore-size cellulose acetate membrane, and stored at four°C until use.

For lentiviral-mediated reprogramming, passage v–7 HFs were cultured in fibroblast medium consisting of DMEM/F12 (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 10 μg/ml of antibiotics–antimycotics (Gibco, Carlsbad, CA, USA) at 37°C and five% COtwo. When fibroblasts reached 80% confluency, they were harvested using Trypsin-EDTA (Gibco, Carlsbad, CA, U.s.) and replated at 3 × 104 cells per square centimeter in six-well civilisation plates and transduced with a combination of O2S and K2M lentiviral vectors. After xx h of transduction, the medium was discarded and replaced with a fresh fibroblast medium. At the seventh day post transduction (p.t.), transduced cells were harvested by trypsinization and replated at 1.2–2.5 × 104 cells per square centimeter onto hESC-qualified Matrigel-coated (Corning, Bedford, MA, USA) vi-well plates (Corning) and cultured in E8 defined medium (Gibco, Carlsbad, CA, U.s.a.; Beers et al., 2012). Between days 20 and 23 p.t., compact rounded colonies with embryonic stem prison cell-like (ESC-similar) morphology were harvested using 0.1% collagenase IV and mechanically isolated and transferred to hESC-qualified Matrigel-coated 48-well plates and maintained in E8 medium with daily media replacement. Selected iPSC colonies were expanded for 10 passages for further analysis.

Alkaline Phosphatase Activeness Assay

Alkali metal phosphatase activeness detection was performed using the colorimetric assay SigmaFast™ BCIP®/NBT (Sigma, St. Louis, MO, United states of america) post-obit manufacturer's instruction. SigmaFast tablet was dissolved in 10 ml of deionized water, resulting in a ready-to-employ solution. The iPSC civilization medium was removed, and cells were washed with one× TBS buffer (Bio-Rad, Richmond, CA, United states of america), and SigmaFast solution was added and incubated for 20 min at room temperature (RT). Finally, cells were washed with 1× PBS (Bio-Rad, Richmond, CA, USA), and positive colonies were observed and photograph-documented with an inverted stage-dissimilarity microscope (Olympus IX71).

RT-PCR Transgene Silencing and Endogenous Pluripotency Gene Expression Analysis

Total RNA was isolated from whole-cell lysates using TRIzol (Invitrogen, CA, United states) reagent, and RNA purification was performed using the RNeasy Mini kit (Qiagen, Germantown, Maryland) according to the manufacturer's instructions and quantified by spectrophotometry with Epoch (BioTek). Reverse transcription was performed using the 1-Step RT-PCR (Qiagen, Germantown, Maryland) according to the manufacturer'southward instructions. To confirm the transgene silencing of iPSC, transgene-specific primers (pSIN4-EF2-O2S: forward five′ CAGTGCCCGAAACCCACAC 3′; contrary v′ GCTCGTCAAGAAGACAGGGCCA three′; 550 bp; and pSIN4-CMV-K2M: frontward 5′ CAAGTCCCGCCGCTCCATTACCAA 3′; contrary: 5′ GCTCGTCAAGAAGACAGGGCCA 3′; 551 bp) were used. Furthermore, to ostend endogenous pluripotency gene expression, specific primers (OCT4: forwards 5′ GACAGGGGGAGGGGAGGAGCTAGG three′; opposite: five′ CCTCCAACCAGTTGCCCCAAACTCCC 3′; 140 bp; and NANOG: frontward 5′ GGACACTGGCTGAATCCTTCC three′; reverse: 5′ CTCGCTGATTAGGCTCCAACC iii′; 143 bp) were used. GAPDH (GA3PDH: forward 5′ AAGGTGAAGGTCGGAGTCAA 3′; reverse: 5′ AATGAAGGGGTCATTGATGG three′; 108 bp) were used equally an internal control. PCR products were analyzed by electrophoresis in 2% agarose gels stained with ethidium bromide (Sigma, St. Louis, MO, USA).

Immunofluorescence Staining of iPSCs and iPSC-Derived Neurons

iPSCs, passages 14–17, were seeded on hESC-qualified Matrigel-coated plates. iPSCs were fixed with 4% PFA (Sigma, St. Louis, MO, U.s.a.) for twenty min at RT. After, cells were permeabilized and blocked with 0.3% Triton Ten-100 (Sigma, St. Louis, MO, USA) in PBS and 1% of bovine serum albumin (Sigma, St. Louis, MO, Usa) for ane h at RT. Afterward washing 3 times for v min with TBS buffer containing 0.1% (v/v) Tween-xx (TBST), the cultures were incubated with primary antibodies in the blocking solution at 4°C overnight. The post-obit principal antibodies were used: 1:ii,000 SOX2 (Abcam True cat# ab97959, RRID: AB_2341193), i:400 Nanog (Jail cell Signaling Engineering Cat# 4903, RRID: AB_10559205), 1:1,000 OCT4 (Abcam True cat# ab19857, RRID: AB_445175), 1:1,000 TRA-1-60 (Abcam Cat# ab16288, RRID: AB_778563), 1:1,000 SSEA4 (Abcam True cat# ab16287, RRID: AB_778073), 1:500 Nestin (Abcam Cat# ab18102, RRID: AB_444246), ane:500 MAP2 (Abcam Cat# ab11267, RRID: AB_297885), 1:i,000 Tuj-ane (Abcam Cat# ab215037), and ane:500 Aβ D54D2 antibiotic (Cell Signaling Technology Cat# 8243, RRID: AB_2797642). And so, cells were washed and incubated for 2 h at RT with 1:1, 000 Alexa 488 anti-mouse (Molecular Probes Cat# A-11017, RRID: AB_143160) and Alexa 594 anti-rabbit (Molecular Probes Cat# A-11012, RRID: AB_141359) or Alexa 488 anti-rabbit (Molecular Probes True cat# A-11070, RRID: AB_142134) and Alexa 594 anti-mouse (Molecular Probes Cat# A-11005, RRID: AB_141372) secondary antibodies. Finally, for nuclei counterstaining, cells were incubated with ane μg/ml Hoechst 33342 (Thermo Scientific, Rockford, IL, United states of america) for 10 min and visualized in an inverted fluorescence microscope (Olympus IX71), and image processing was performed with QuickCapture software. For 3D cultures, all incubations were prolonged overnight with gentle rocking, and besides washes were prolonged to xx min with gentle rocking.

3D Jail cell Culture and iPSC Neural Differentiation

Neural induction of iPSC, passage 14–17, was performed according to a previously reported dual SMAD inhibition protocol (Shi et al., 2012; Qi et al., 2017) with some modifications. Beginning, iPSCs were cultured onto hESC-qualified Matrigel-coated 24-well plates in E8 medium until they reached 80% confluence, at which point the E8 medium was switched to neural induction medium (NIM) consisting of DMEM/F12 supplemented with five μM SB431542 (Sigma, St. Louis, MO, USA), 0.one μM LDN193189 (Sigma, St. Louis, MO, USA), 1× N2 (Gibco, Carlsbad, CA, The states), 0.5× B27 (Gibco, Carlsbad, CA, United states), and x μg/ml of antibody, with daily medium replacement for 5 days. After 5 days of neural consecration, the rosettes formed were dissociated into clumps using 0.1% collagenase IV (Sigma, St. Louis, MO, United states of america) and replated onto a Matrigel basement matrix (Corning, Bedford, MA, Us). This 3D culture was performed in accordance with Kim et al. (2015) with modifications. A Matrigel basement matrix stock solution was diluted (1:1 dilution ratio) with water ice-common cold neural differentiation medium (NDM) consisting of Neurobasal medium (Gibco, Carlsbad, CA, USA) supplemented with fifteen ng/ml BDNF and GDNF neurotrophic factors (PeproTech, Rocky Colina, NJ, USA), ane μM PD0325901 (Sigma, St. Louis, MO, Us), and ten μM Forskolin (Sigma, St. Louis, MO, USA), and and so vortexed for 5 s. Immediately, the prepared dilution was transferred into 48-well plates (200 μl in each well); then plates were incubated for 20 min at 37°C to form a 3D gel layer at the lesser of the well. Afterwards, dissociated rosettes (split 1:2) were plated onto the Matrigel matrix basement in prewarmed NDM for neural maturation. The next day, the 3D prison cell culture was exposed to 5 μM DAPT (Sigma, St. Louis, MO, The states) for 24 h. The 3D cultures were maintained for 2 weeks, with media replacement every ii days.

Protein Extraction and Western Blot (WB) Assay

The 3D cultures were homogenized with RIPA (Sigma, St. Louis, MO, USA) extraction buffer containing 1 mM protease inhibitor mixture (Sigma, St. Louis, MO, The states) and 1 mM orthovanadate inhibitor (Sigma, St. Louis, MO, U.s.a.). After incubation on ice for 10 min, the samples were centrifuged for 10 min at 8,000 g. Tris-tricine SDS-Folio (Bio-Rad, Richmond, CA, U.s.) was performed as previously described (Reza-Zaldivar et al., 2019), with few modifications to verify the Aβ aggregates' beingness. Proteins were resolved on four–16% gradient gels; later on, the proteins were transferred to a PVDF membrane (Millipore, Billerica, MA, USA); the membrane was fixed in glutaraldehyde (Sigma, St. Louis, MO, USA) at 0.5% for 10 min. Later on 3 TBS-T washes, the membranes were incubated overnight at iv°C with 0.5 μg/ml Aβ anti-rabbit antibody and then were incubated with 1:5,000 hP-conjugated anti-rabbit secondary antibody (Vector, Burlingame, CA, U.s.) for 2 h at RT. Membrane exposure was performed by chemiluminescence using Luminata Forte (Millipore, Burlington, MA, The states) and was visualized by the ChemiDoc™ XRS system and Prototype Lab 6.0.ane software.

Results

Generation of iPSCs From HFs Harboring A246E PSEN1 Mutation and Control HFs

The development of technologies to reprogram adult somatic cells, including HFs, to iPSCs has fabricated possible the generation of patient-specific stem cells and has been used to generate several models with inherited neurodegenerative conditions. We established two iPSC cultures, one with PSEN1 mutation A246E (iFLAG; i: iPSC, F: fibroblasts, Fifty: lentivirus, and AG: AG07768 cell line) and the other ane without mutations (iFLN; i: iPSC, F: fibroblasts, L: lentivirus, and N: non-mutated), both via the HF transduction of Yamanaka'due south factors containing lentiviral vectors at feeder-free conditions. Except for minor modifications, the overall reprogramming process was basically as previously reported by Cevallos et al. (2018). On iii weeks p.t., we observed colonies with prominent nucleoli, a high ratio of nucleus to cytoplasm, and tightly packed, reminiscent of ESC-like, morphology (Thomson et al., 1998). iPSCs with the greatest corporeality of previously described qualities were selected and expanded during ten passages to exam for the stability of self-renewal capacity. The representatives of these iPSCs were used for purposes of assay and neurogenesis (Figure one).

www.frontiersin.org

Effigy 1. Generation of induced pluripotent stem cells (iPSCs). (A) Day 0. Human fibroblast culture. Scale 50 μm, twenty× amplification. (B) Representative derived iPSCs using lentiviral vectors containing Yamanaka's factors in feeder-free conditions later ten passages. iPSCs have flat, rounded, and compact morphology, a high ratio of nucleus to the cytoplasm and prominent nucleoli embryonic stem jail cell-like (ESC-like). From left to correct, iPSCs iv× amplification, 100 μm scale; 10× amplification, 100 μm scale; and 20× distension, scale 50 μm.

iPSC Characterization

Outset, we tested the pluripotency of the colonies via the analysis of the alkaline phosphatase activity (Figure 2A) and the expression of representative marker characteristics of ESCs, which included NANOG, OCT4, SOX2, SSEA4, and TRA-i-sixty (Effigy 2B). We demonstrated the activation of endogenous pluripotency-related genes, OCT4 and NANOG, and the silencing of the lentiviral transgene'due south expression by RT-PCR (Figures 2C,D, respectively). The best transgene shutoff and endogenous expression of stem cell genes were used as the criteria of the established pluripotency.

www.frontiersin.org

Figure 2. iPSC pluripotency expression. iPSCs were characterized using standard pluripotency assays. Representative images are shown. (A) iPSCs showed alkali metal phosphatase activeness. (B) Immunofluorescence staining showed nuclear marker (scarlet) and cell surface (light-green) pluripotency marker expressions in iPSCs, including NANOG, OCT4, SOX2, and SSEA4, and TRA-1-60. Hoechst nuclear staining in bluish. Calibration bars 50 μm. (C) Expression of pluripotency-related endogenous genes, OCT4 and Nanog, was detected in derived iPSCs by RT-PCR assay. hESCs were used as a positive control (Ctrl+), and human being fibroblasts (HFs) were used every bit a negative control (Ctrl−) for endogenous pluripotency gene expression. (D) Some iPSC clones expressed the transgenes (data not shown), whereas fully reprogrammed iPSCs consistently exhibited lentiviral silencing or attenuation (iFLAG and iFLN). HFs at twenty-four hours 5 p.t. were used as a positive control (Ctrl+ HFs D5 p.t.) for transgene expression, and HFs were used as a negative control (Ctrl− HFs). GAPDH was used as an internal command.

AD 3D Model Institution

We established hydrogel 3D man models for Advert (Ad 3D model) and healthy (nonmutated 3D model) neurons. For their establishment, the iPSCs were cultured until 80% confluence. So the iPSC medium was changed by NIM for 5 days. During the differentiation procedure, the cells in the periphery of the colonies inverse their morphology to a rosette-similar appearance. On day 5 of neural induction, nosotros performed immunofluorescence to assess the neural forerunner cells' (NPCs) identity past Nestin expression (Effigy 3). NPCs had a potent proliferative potential and were passaged every 4–6 days to allow population expansion. Later on, NPCs were subcultured and replated onto the Matrigel matrix basement. By 14 days of differentiation, all 3D neuronal cultures exhibited MAP2 and TUJ1 expression (Figure 4). This 3D neural differentiation protocol (Effigy five) was efficient in generating neural cells within 14 days, with a simple and economical method in comparing with other works.

www.frontiersin.org

Figure 3. Immunofluorescence staining of neural precursor jail cell (NPC) marker Nestin. Representative images indicate Nestin expression in NPCs on day 5 post neural induction. Nuclear staining in blue with Hoechst. Scale confined 50 μm.

www.frontiersin.org

Figure four. Neuronal marker expression in the three-dimensional (3D) cultures. Representative images are shown. At day fourteen, nosotros performed immunofluorescence and iPSC-derived neurons in 3D culture expressed TUJ-1 and MAP2 neuronal markers in crimson. Nuclear staining in blue with Hoechst. Calibration bars 100 μm.

www.frontiersin.org

Figure 5. 3D iPSC neural differentiation scheme. iPSCs were plated onto hESC-qualified Matrigel-coated 24-well plates in an E8 medium (D0) until 80% of confluence. So the E8 medium was replaced by neural induction medium (NIM) for neural induction with daily medium replacement for 5 days. On the 5th solar day (D5) of neural induction, 3D Matrigel basement matrices were prepared in accord with Kim et al. (2015) with modifications. A Matrigel basement matrix stock solution was diluted (1:1 dilution ratio) with ice-common cold neural differentiation medium (NDM) and then vortexed for v s. Immediately, the prepared dilution was transferred into 48-well plates (200 μl in each well); then the plates were incubated for 20 min at 37°C to course a 3D gel layer at the lesser of the well. Later on, NPCs were dissociated into clumps using 0.i% collagenase Four and replated (Divide ane:ii) onto a Matrigel basement matrix in prewarmed NDM for neural maturation. The adjacent day, the 3D cell culture was exposed to 5 μM DAPT for 24 h. The 3D cultures were maintained for 2 weeks, with media replacement every two days. At D14, the 3D neural cell cultures were observed and analyzed.

Aβ Marker Expression and Aggregation in AD 3D Neuronal Civilization

After establishing the Advertizing 3D model, in order to clarify Aβ marker expression and aggregation associated with PSEN1 function and dysfunction in NPCs/early neurons (fourteen-day differentiation), we performed immunofluorescence and a WB analysis. First, nosotros performed immunofluorescent analysis with the anti-Aβ antibody D54D2 previously extensively used (for references on its use, visit the Jail cell Signaling website) to recognize several amyloid isoforms (Aβ37, Aβ38, Aβ39, Aβ40, and Aβ42). We detected immunopositive staining for this anti-Aβ antibody that co-localized with MAP2 (yellowish arrows, Effigy 6A) but was not detectable in neurons lacking the AD mutation. To validate the observed Aβ aggregation, nosotros used a WB test using equally a positive command a commercial Aβ (Aβ Ctrl+) preliminarily incubated for 5 days at 37°C to let Aβ aggregation. Every bit a result, in the proteins from the AD 3D neurons but not from the nonmutated 3D neurons, several protein bands were detected corresponding to monomers and oligomers with a molecular mass ranging from v to 50 kDa. The band with a molecular mass of ~50 kDa corresponding to Aβ oligomers was the main consequence (Figure 6B) evidencing that the Aβ had undergone an oligomerization in the Advertisement patient-derived 3D neuronal model compatible with the previous report of Raja et al. (2016).

www.frontiersin.org

Figure 6. Amyloid-β (Aβ) marker expression and Aβ aggregation in the Alzheimer's disease (AD) 3D model. Representative images are shown. (A) Immunofluorescence staining indicates Aβ marker expression in the Advert 3D model. TUJ-i (green), Aβ (red), and MAP2 (cerise) and Aβ (green). Co-3D model, Aβ marking expression was non detected. TUJ-1 (red) and Aβ (dark-green). Nuclei were stained in blueish with Hoechst. Scale bars 25 μm. (B) Aβ oligomers were detected by western blot (WB) analysis in the Advert 3D model as a protein band with a molecular mass of ~50 kDa and were absent in the non-mutated 3D model. β-Actin was expressed past mutated and non-mutated cells. These assays were performed at 14 days mail service neural induction.

Discussion

Show from cellular biology, creature models, and genetics suggests that Aβ protein oligomerization and aggregation play a central role in the initiation and progression of AD. Still, the specific pathophysiological mechanisms of the toxic Aβ species by which these processes requite rise to the pathogenesis of AD go on to be nether discussion. With iPSC applied science, we can access iPSC-derived neurons from AD patients' somatic cells carrying Advert-associated mutations, which have mostly been used to model in vitro several neurodegenerative weather condition, such as AD (Penney et al., 2020). Here, we established 2 iPSC cultures derived from fibroblasts of healthy and diseased individuals, the latter carrying the PSEN1 mutation A246E, which showed defined morphology, phosphatase alkaline action, ESC markers, and cistron expression and were further expanded for 10 passages, demonstrating that mutated and nonmutated HFs were successfully reprogrammed and established into iPSC as previously demonstrated (Yagi et al., 2011; Muñoz et al., 2018).

In the last 5 years, in vitro models of AD take been improved by using 3D environments (Logan et al., 2019), amongst which the simplest involves differentiating iPSCs and NPCs into neurons. Hydrogels are cantankerous-linked polymer networks that are easy to employ, mechanically similar to the key nervous system tissue; are permeable for nutrients and oxygen; are hydrophilic; and are fabricated from different constructed and natural materials, such as Matrigel matrix, alginate, and chitosan (Frampton et al., 2011; Hopkins et al., 2013). Hither, nosotros did not embed the cells onto the Matrigel matrix basement, but we first made the basement and so seeded the cells onto the Matrigel basement, since, on the contrary, the cells did non survive; however, the cells entered the matrix within one twenty-four hour period.

Although 3D models represent a substantial step forrard in in vitro AD modeling, crucial models consisted of the use of genetically manipulated NPCs-derived neurons which overexpressed AD-related mutations in APP and PSEN1 genes (Choi et al., 2014) and were exposed to exogenous Aβ toxic species (Zhang et al., 2014). Otherwise, cocky-organizing AD 3D models efficiently produce Advertizing phenotypes without genetic manipulation or exogenous Aβ addition (Raja et al., 2016); notwithstanding, these cocky-organizing models lack controlled access of nutrients while the hydrogel-based 3D cultures offer a suitable stiffness for neural cells and a higher degree of command of the cellular context. Also, 3D models being suitable in recapitulating brain tissue-similar environments showed advantages in reconstituting Advertisement-specific extracellular assemblage of Aβ (Choi et al., 2014). This may be because 3D models increase the number of synaptic contacts, which in turn probably facilitates self-assembly and aggregation of Aβ in neurites. Several aggregation states of self-assembling 4.5-kDa Aβ monomers have been identified: trimers and tetramers of, approximately, thirteen and 17 kDa, respectively; 30- to 83-kDa oligomers; and the highest-sized (>100 kDa) insoluble fibrils that were deposited in the brain, giving rise to amyloid plaques (Pryor et al., 2012). In the present work, we testify that neurons derived from a patient carrying the pathogenic A246E mutation in the PSEN1 gene in a hydrogel-based 3D model of AD produced Aβ aggregates with a molecular mass of ~fifty kDa, corresponding to Aβ oligomers, without the demand of mutation insertions or exposing the cells to synthetic Aβ, one of the two main pathological features of AD. Furthermore, in this written report, we demonstrated by immunofluorescence that AD patient-derived neurons at twenty-four hour period 14 of differentiation already showed Aβ protein expression. The presence of oligomers in the absenteeism of amyloid plaques in this AD 3D model could be due to the short time of culture (14 days of neuronal differentiation), which can be considered an advantage of this model, permitting observation of the initial stages of the Aβ oligomerization in a brusque period of fourth dimension (fourteen days), relevant for the evolution of prevention strategies. We consider that this 3D modeling is simpler and technically more feasible, thus contributing to the field of AD modeling.

Neural cells are an essential cell type to study the Advertisement context; for that reason, several groups take established multiple in vitro iPSC-derived neuron differentiation protocols (Chambers et al., 2009; Shi et al., 2012; Paşca et al., 2015; Qi et al., 2017; Logan et al., 2019). Many of these protocols have focused on differentiating neurons from EOAD and LOAD patient-specific iPSCs and have shown that EOAD iPSCs expressed pathogenic mutation and that these neurons tin can be consistently differentiated into phenotypical and physiological neurons with amyloidogenic properties and also other fundamental events of the Advertising pathogenic pour (Israel et al., 2012; Mahairaki et al., 2014; Hossini et al., 2015). In this work, we obtained neurons derived from mutant and nonmutant iPSCs by dual SMAD inhibition and small molecules that raise neural fate derivation under feeder-free conditions, equally previously reported by Qi et al. (2017) with few modifications. We induced iPSC differentiation into neural cells by blocking the TGF-β and BMP signaling pathways through a dual SMAD inhibition. So we were able to expand Nestin-positive NPCs for final differentiation into neurons in 3D culture atmospheric condition. Neural mark expression is essential, given that it indicates that stem cells ceased their pluripotency and its fate was determined to neural lineage. For that reason, we evaluated neural marker expression in our 3D model where the neural differentiation protocol implemented was successful in generating neural cells positive for MAP2 and TUJ-1 neural markers within nine days of differentiation from NPCs, using an easy and inexpensive method to establish our AD 3D model and the nonmutated 3D model. Our protocol is cheaper in the sense that we used lower concentrations of neural induction and differentiation molecules as well equally fewer supplements that constitute the induction and differentiation media, in comparison with previous reports (Shi et al., 2012; Qi et al., 2017).

While many advances take been made, challenges to creating comprehensive 3D human culture models for AD study and comprehension nonetheless lie ahead. Although current AD 3D culture models have successfully recapitulated hallmarks of Advertizement, ane of the major challenges is the low optical transparency during high-resolution imaging due to the thick nature of the civilization. Another disadvantage of the current 3D cultures is the insufficient maturation and aging of neural cells and also the lack of functional tests such as behavior assessments (Choi et al., 2016).

Despite the unresolved challenges, the research community continues to refine them to facilitate novel insights into AD pathophysiology. Therefore, the application of these AD 3D models may be express to the early stages of the illness progression.

These results, in accordance with those previously reported, clearly demonstrate that 3D cell culture conditions tin can accelerate AD pathogenesis in Advertisement 3D models, by promoting local Aβ deposition, whereas in conventional monolayer cell cultures, the secreted Aβ might diffuse into cell culture media and be removed during regular media changes, preventing its aggregation (Choi et al., 2014; Raja et al., 2016). However, even though our Ad 3D model just recapitulates oligomer formation, information technology might be considered as a valid model to study the initial stages of the disease that precede Aβ product and oligomer formation. Moreover, these sorts of results support the Aβ hypothesis of Advertizement that states that the accumulation of Aβ is the initial pathological trigger in the disease. The backlog accumulation of Aβ and so elicits a pathogenic cascade, including synaptic deficits, altered neuronal activity, inflammation, oxidative stress, neuronal injury, hyperphosphorylation of tau causing neurofibrillary tangles (NFTs), and, ultimately, neuronal decease and dementia (Choi et al., 2015), thus contributing to overcoming the limitations and drawbacks previously mentioned.

Taken together, our study indicates that the described hydrogel-based AD 3D culture tin model some AD phenotypes, such as Aβ oligomer formation, and provide a valid experimental platform for genetic forms of Advertising that highlights its potential applications for studying the earliest AD molecular mechanisms underlying the pathology, investigation of the efficacy and potential toxicity of candidate AD drugs, the discovery of new diagnostic biomarkers of Advertizing, and the design of personalized therapeutic strategies; could eventually permit for the identification and treatment of patient-specific alterations underlying the disease; and also would contribute to fill the gap betwixt the results from in vivo fauna and in vitro human models to minimize the failures of clinical trials.

Data Availability Statement

The raw information supporting the conclusions of this commodity will be made available by the authors, without undue reservation, to whatsoever qualified researcher.

Ethics Argument

The protocol of reprogramming used was approved by the Ethic Committee of the Establish of Biomedical Enquiry where the experiments on generation have been done. Man fibroblasts (HFs) carrying the A246E PSEN1 mutation were kindly donated by the Coriell Institute for Medical Enquiry; and the HFs without mutation were purchased from ATCC (USA).

Author Contributions

The laboratories of the CIATEJ and the UNAM contributed equally to this piece of work. AC-A and KG: funding acquisition. MH-Due south, ER-Z, RC, AM-A, KG and AC-A: investigation. MH-South, ER-Z, and RC: methodology. Air-conditioning-A, KG, and AM-A: supervision. MH-South: writing original draft. MH-S, ER-Z, RC, AM-A, KG, and AC-A: writing, review and editing.

Funding

This work was financed by the CONACYT scholarship 590342, Fondo Mixto de Ciencia y Tecnología del Estado de Jalisco grant JAL-2014-0-250508, and the CONACYT funding grant #201382 to KG.

Disharmonize of Interest

The authors declare that the enquiry was conducted in the absence of any commercial or financial relationships that could exist construed as a potential conflict of interest.

Acknowledgments

We thank the Coriell Institute for Medical Research for providing the fibroblast cells AG07768 conveying the A246E mutation. Also, we thank the members of the Laboratorio de Reprogramación Celular, Departamento de Medicina Genómica y Toxicología Ambiental, Instituto de Investigaciones Biomédicas, UNAM, directed by Dr. Karlen Gazarian, for their contribution to the reprogramming of the cells used in the present work, as well as, for the characterization tests of the iPSCs obtained.

Footnotes

  1. ^ http://world wide web.alzforum.org/mutations

References

Beers, J., Gulbranson, D. R., George, Due north., Siniscalchi, 50. I., Jones, J., Thomson, J. A., et al. (2012). Passaging and colony expansion of human pluripotent stalk cells past enzyme-free dissociation in chemically defined civilisation conditions. Nat. Protoc. 7, 2029–2040. doi: x.1038/nprot.2012.130

PubMed Abstract | CrossRef Total Text | Google Scholar

Cacace, R., Sleegers, M., and Van Broeckhoven, C. (2016). Molecular genetics of early-onset alzheimer's illness revisited. Alzheimers Dement. 12, 733–748. doi: ten.1016/j.jalz.2016.01.012

PubMed Abstract | CrossRef Full Text | Google Scholar

Cevallos, R. R., Rodríguez-Martínez, G., and Gazarian, One thousand. (2018). Wnt/β-catenin/TCF pathway is a phase-dependent promoter of colony formation and mesendodermal differentiation during human somatic cell reprogramming. Stem Cells 36, 683–695. doi: 10.1002/stem.2788

PubMed Abstract | CrossRef Full Text | Google Scholar

Chambers, Southward. M., Fasano, C. A., Papapetrou, Due east. P., Tomishima, G., Sadelain, M., and Studer, L. (2009). Highly efficient neural conversion of homo ES and iPS cells past dual inhibition of SMAD signaling. Nat. Biotechnol. 27, 275–280. doi: 10.1038/nbt.1529

PubMed Abstract | CrossRef Full Text | Google Scholar

Choi, Southward. H., Kim, Y. H., D'Avanzo, C., Aronson, J., Tanzi, R. E., and Kim, D. Y. (2015). Recapitulating amyloid β and tau pathology in human being neural prison cell culture models: clinical implications. US Neurol. eleven, 102–105. doi: 10.17925/USN.2015.xi.02.102

PubMed Abstract | CrossRef Full Text | Google Scholar

Choi, S. H., Kim, Y. H., Hebisch, M., Sliwinski, C., Lee, S., D'Avanzo, C., et al. (2014). A 3-dimensional homo neural cell culture model of Alzheimer's disease. Nature 515, 274–278. doi: ten.1038/nature13800

PubMed Abstract | CrossRef Full Text | Google Scholar

Choi, S. H., Kim, Y. H., Quinti, L., Tanzi, R. E., and Kim, D. Y. (2016). 3D culture models of Alzheimer'south disease: a route map to a "cure-in-a-dish". Mol. Neurodegener. 11, 75–75. doi: 10.1186/s13024-016-0139-vii

PubMed Abstract | CrossRef Total Text | Google Scholar

D'Avanzo, C., Aronson, J., Kim, Y. H., Choi, S. H., Tanzi, R. E., and Kim, D. Y. (2015). Alzheimer's in 3D civilisation: challenges and perspectives. Bioessays 37, 1139–1148. doi: 10.1002/bies.201500063

PubMed Abstruse | CrossRef Full Text | Google Scholar

de Leeuw, Southward., and Tackenberg, C. (2019). Alzheimer'south in a dish—induced pluripotent stem jail cell-based disease modeling. Transl. Neurodegener. 8:21. doi: 10.1097/00002093-198802030-00015

PubMed Abstract | CrossRef Full Text | Google Scholar

Frampton, J. P., Hynd, Chiliad. R., Shuler, Chiliad. L., and Shain, Due west. (2011). Fabrication and optimization of alginate hydrogel constructs for use in 3D neural cell culture. Biomed. Mater. 6:015002. doi: 10.1088/1748-6041/half-dozen/1/015002

PubMed Abstract | CrossRef Full Text | Google Scholar

Gonzalez, C., Armijo, Due east., Bravo-Alegria, J., Becerra-Calixto, A., Mays, C. Eastward., and Soto, C. (2018). Modeling amyloid β and tau pathology in human cognitive organoids. Mol. Psychiatry 23, 2363–2374. doi: x.1038/s41380-018-0229-8

PubMed Abstract | CrossRef Full Text | Google Scholar

Graham, W. 5., Bonito-Oliva, A., and Sakmar, T. P. (2017). Update on Alzheimer'due south disease therapy and prevention strategies. Annu. Rev. Med. 68, 413–430. doi: 10.1146/annurev-med-042915-103753

PubMed Abstract | CrossRef Full Text | Google Scholar

Hopkins, A. Chiliad., De Laporte, L., Tortelli, F., Spedden, E., Staii, C., Atherton, T. J., et al. (2013). Silk hydrogels as soft substrates for neural tissue engineering. Adv. Funct. Mater. 23, 5140–5149. doi: ten.1002/adfm.201300435

CrossRef Full Text | Google Scholar

Hossini, A. M., Megges, Grand., Prigione, A., Lichtner, B., Toliat, M. R., Wruck, W., et al. (2015). Induced pluripotent stem cell-derived neuronal cells from a sporadic Alzheimer'south disease donor as a model for investigating Ad-associated gene regulatory networks. BMC Genomics 16:84. doi: 10.1186/s12864-015-1262-five

PubMed Abstract | CrossRef Total Text | Google Scholar

Israel, K. A., Yuan, S. H., Bardy, C., Reyna, S. Grand., Mu, Y., Herrera, C., et al. (2012). Probing sporadic and familial Alzheimer'due south disease using induced pluripotent stem cells. Nature 482, 216–220. doi: ten.1038/nature10821

PubMed Abstruse | CrossRef Total Text | Google Scholar

Kim, Y. H., Choi, Due south. H., D'Avanzo, C., Hebisch, Thou., Sliwinski, C., Bylykbashi, E., et al. (2015). A 3D human neural jail cell civilisation system for modeling Alzheimer's disease. Nat. Protoc. 10, 985–1006. doi: 10.1038/nprot.2015.065

PubMed Abstract | CrossRef Full Text | Google Scholar

Lanoiselée, H. One thousand., Nicolas, G., Wallon, D., Rovelet-Lecrux, A., Lacour, 1000., Rousseau, S., et al. (2017). APP, PSEN1 and PSEN2 mutations in early-onset alzheimer disease: a genetic screening written report of familial and sporadic cases. PLoS Med. 14:e1002270. doi: 10.1371/journal.pmed.1002270

PubMed Abstract | CrossRef Total Text | Google Scholar

Liao, M. C., Muratore, C. R., Gierahn, T. Chiliad., Sullivan, Due south. East., Srikanth, P., De Jager, P. 50., et al. (2016). Single-prison cell detection of secreted Aβ and sAPPα from human being IPSC-derived neurons and astrocytes. J. Neurosci. 36, 1730–1746. doi: 10.1523/JNEUROSCI.2735-15.2016

PubMed Abstruse | CrossRef Full Text | Google Scholar

Logan, S., Arzua, T., Canfield, Southward. G., Seminary, E. R., Sison, S. 50., Ebert, A. D., et al. (2019). Studying human neurological disorders using induced pluripotent stem cells: from second monolayer to 3D organoid and blood encephalon barrier models. Compr. Physiol. nine, 565–611. doi: 10.1002/cphy.c180025

PubMed Abstract | CrossRef Full Text | Google Scholar

Mahairaki, V., Ryu, J., Peters, A., Chang, Q., Li, T., Park, T. S., et al. (2014). Induced pluripotent stem cells from familial Alzheimer's disease patients differentiate into mature neurons with amyloidogenic properties. Stem Cells Dev. 23, 2996–3010. doi: 10.1089/scd.2013.0511

PubMed Abstract | CrossRef Full Text | Google Scholar

Masters, C. L., Bateman, R., Blennow, K., Rowe, C. C., Sperling, R. A., and Cummings, J. L. (2015). Alzheimer's affliction. Nat. Rev. Dis. Primers i:15056. doi: 10.1038/nrdp.2015.56

PubMed Abstruse | CrossRef Total Text | Google Scholar

Mohamet, L., Miazga, N. J., and Ward, C. Thousand. (2014). Familial Alzheimer'southward disease modelling using induced pluripotent stalk jail cell technology. World J. Stem Cells vi, 239–247. doi: 10.4252/wjsc.v6.i2.239

PubMed Abstruse | CrossRef Total Text | Google Scholar

Muñoz, South. Due south., Balez, R., Castro Cabral-da-Silva, One thousand. E., Berg, T., Engel, K., Bax, M., et al. (2018). Generation and label of homo induced pluripotent stem cell lines from a familial Alzheimer's disease PSEN1 A246E patient and a non-demented family unit fellow member bearing wild-type PSEN1. Stalk Prison cell Res. 31, 227–230. doi: 10.1016/j.scr.2018.08.006

PubMed Abstruse | CrossRef Full Text | Google Scholar

Paşca, A. M., Sloan, South. A., Clarke, Fifty. E., Tian, Y., Makinson, C. D., Huber, N., et al. (2015). Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat. Methods 12, 671–678. doi: 10.1038/nmeth.3415

PubMed Abstract | CrossRef Full Text | Google Scholar

Pryor, N. E., Moss, M. A., and Hestekin, C. N. (2012). Unraveling the early on events of amyloid-β protein (Aβ) aggregation: techniques for the determination of Aβ amass size. Int. J. Mol. Sci. 13, 3038–3072. doi: ten.3390/ijms13033038

PubMed Abstract | CrossRef Full Text | Google Scholar

Qi, Y., Zhang, X. J., Renier, North., Wu, Z., Atkin, T., Sunday, Z., et al. (2017). Combined small-molecule inhibition accelerates the derivation of functional cortical neurons from human pluripotent stem cells. Nat. Biotechnol. 35, 154–163. doi: 10.1038/nbt.3777

PubMed Abstract | CrossRef Full Text | Google Scholar

Raja, Westward. K., Mungenast, A. E., Lin, Y. T., Ko, T., Abdurrob, F., Seo, J., et al. (2016). Self-organizing 3D human neural tissue derived from induced pluripotent stem cells restate Alzheimer's disease phenotypes. PLoS One 11:e0161969. doi: x.1371/journal.pone.0161969

PubMed Abstract | CrossRef Full Text | Google Scholar

Ravi, K., Paramesh, V., Kaviya, S. R., Anuradha, E., and Solomon, F. D. P. (2015). 3D jail cell culture systems: advantages and applications. J. Cell. Physiol. 230, sixteen–26. doi: 10.1002/jcp.24683

PubMed Abstruse | CrossRef Full Text | Google Scholar

Reiss, A. B., Arain, H. A., Stecker, M. Chiliad., Siegart, N. M., and Kasselman, L. J. (2018). Amyloid toxicity in Alzheimer'due south disease. Rev. Neurosci. 29, 613–627. doi: ten.1515/revneuro-2017-0063

PubMed Abstract | CrossRef Full Text | Google Scholar

Reza-Zaldivar, Due east. E., Hernández-Sapiens, M. A., Gutiérrez-Mercado, Y. K., Sandoval-Ávila, S., Gomez-Pinedo, U., Márquez-Aguirre, A. Fifty., et al. (2019). Mesenchymal stem jail cell-derived exosomes promote neurogenesis and cognitive function recovery in a mouse model of Alzheimer's disease. Neural Regen. Res. fourteen, 1626–1634. doi: 10.4103/1673-5374.255978

PubMed Abstract | CrossRef Total Text | Google Scholar

Sanabria-Castro, A., Alvarado-Echeverría, I., and Monge-Bonilla, C. (2017). Molecular pathogenesis of Alzheimer'due south illness: an update. Ann. Neurosci. 24, 46–54. doi: 10.1159/000464422

PubMed Abstract | CrossRef Full Text | Google Scholar

Saraceno, C., Musardo, S., Marcello, East., Pelucchi, Southward., and Di Luca, M. (2013). Modeling Alzheimer's disease: from by to future. Front. Pharmacol. 4:77. doi: 10.3389/fphar.2013.00077

PubMed Abstruse | CrossRef Full Text | Google Scholar

Shi, Y., Kirwan, P., and Livesey, F. J. (2012). Directed differentiation of human pluripotent stalk cells to cognitive cortex neurons and neural networks. Nat. Protoc. seven, 1836–1846. doi: 10.1038/nprot.2012.116

PubMed Abstruse | CrossRef Total Text | Google Scholar

Sproul, A. A., Jacob, South., Pre, D., Kim, S. H., Nestor, M. W., Navarro-Sobrino, M., et al. (2014). Label and molecular profiling of PSEN1 familial Alzheimer'south affliction iPSC-derived neural progenitors. PLoS Ane 9:e84547. doi: 10.1371/journal.pone.0084547

PubMed Abstract | CrossRef Full Text | Google Scholar

Takahashi, Yard., and Yamanaka, Southward. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures past defined factors. Jail cell 126, 663–676. doi: 10.1016/j.prison cell.2006.07.024

PubMed Abstract | CrossRef Total Text | Google Scholar

Thomson, J. A., Itskovitz-Eldor, J., Shapiro, Due south. S., Waknitz, 1000. A., Swiergiel, J. J., Marshall, Five. South., et al. (1998). Embryonic stem prison cell lines derived from homo blastocysts. Science 282, 1145–1147. doi: 10.1126/scientific discipline.282.5391.1145

PubMed Abstract | CrossRef Total Text | Google Scholar

Wilson, R. S., Leurgans, South. Eastward., Boyle, P. A., and Bennett, D. A. (2011). Cognitive decline in prodromal alzheimer illness and balmy cognitive damage. JAMA Neurol. 68, 351–356. doi: 10.1001/archneurol.2011.31

PubMed Abstract | CrossRef Full Text | Google Scholar

Yagi, T., Ito, D., Okada, Y., Akamatsu, W., Nihei, Y., Yoshizaki, T., et al. (2011). Modeling familial Alzheimer'due south disease with induced pluripotent stem cells. Hum. Mol. Genet. 20, 4530–4539. doi: 10.1093/hmg/ddr394

PubMed Abstruse | CrossRef Full Text | Google Scholar

Zhang, D., Pekkanen-Mattila, M., Shahsavani, M., Falk, A., Teixeira, A. I., and Herland, A. (2014). A 3D Alzheimer's illness civilisation model and the induction of P21-activated kinase mediated sensing in iPSC derived neurons. Biomaterials 35, 1420–1428. doi: 10.1016/j.biomaterials.2013.11.028

PubMed Abstract | CrossRef Full Text | Google Scholar

rojasoplaw1994.blogspot.com

Source: https://www.frontiersin.org/articles/10.3389/fncel.2020.00151/full

0 Response to "Probing Sporadic and Familial Alzheimer's Disease Using Induced Pluripotent Stem Cells"

Post a Comment

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel